Mcm3ap^em1(IMPC)Ics
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mcm3ap^em1(IMPC)Ics
• Name: minichromosome maintenance complex component 3 associated protein; endonuclease-mediated mutation 1, Mouse Clinical Institute
• MGI ID: MGI:7781821
• Gene: Mcm3ap Location: Chr10:76304761-76351691 bp, + strand Genetic Position: Chr10, 38.88 cM
• Alliance: Mcm3ap^em1(IMPC)Ics page

Mutation origin

• Strain of Origin: C57BL/6N

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at the Institut Clinique de la Souris by electroporating Cas9 protein and 4 sgRNAs (equivalent to CTTAAAATCAAGTGACCACA, GATTTTAAGTCCCACGATCT,TCCTAGCATACCTACGGGGT and CACATCCTAGCATACCTACG), resulting in a 2796 bp deletion that includes exon 3 (ENSMUSE00000131646; GRCm39), leading to a frameshift and premature stop codon. (J:358405)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Mcm3ap Mutation: 77 strains or lines available

References

• Original: J:358405 MGI and ICS/MCI, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC) Generated by ICS/MCI. Database Release. 2024
• All: 1 reference(s)