About   Help   FAQ
Cbr1bem1(IMPC)Ics
Endonuclease-mediated Allele Detail
Summary
Symbol: Cbr1bem1(IMPC)Ics
Name: carbonyl reductase 1B; endonuclease-mediated mutation 1, Mouse Clinical Institute
MGI ID: MGI:7781817
Synonyms: Gm5678em1(IMPC)Ics
Gene: Cbr1b  Location: Chr16:93424985-93427339 bp, + strand  Genetic Position: Chr16, 54.54 cM
Alliance: Cbr1bem1(IMPC)Ics page
Mutation
origin
Strain of Origin:  C57BL/6N
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at the Institut Clinique de la Souris by electroporating Cas9 protein and 4 sgRNAs (equivalent to CCTCATCAAAGGGTTTGCA, AAGGAGATCAGGCCTTAAGC, TTACGGGGTAGGACTCCTT and TATTTGCAGGGTAGGTTACG), resulting in a 2814 bp deletion that includes the proximal promoter and exons 1 and 2 (ENSMUSE00000720738 and ENSMUSE00001039070; GRCm39), leading to the absence of protein. (J:358405)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Cbr1b Mutation:  5 strains or lines available
References
Original:  J:358405 MGI and ICS/MCI, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC) Generated by ICS/MCI. Database Release. 2024;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory