About   Help   FAQ
Paxbp1em1(IMPC)Ics
Endonuclease-mediated Allele Detail
Summary
Symbol: Paxbp1em1(IMPC)Ics
Name: PAX3 and PAX7 binding protein 1; endonuclease-mediated mutation 1, Mouse Clinical Institute
MGI ID: MGI:7781790
Gene: Paxbp1  Location: Chr16:90810925-90841267 bp, - strand  Genetic Position: Chr16, 52.3 cM, cytoband C3.3
Alliance: Paxbp1em1(IMPC)Ics page
Mutation
origin
Strain of Origin:  C57BL/6N
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at the Institut Clinique de la Souris by electroporating Cas9 protein and 4 sgRNAs (equivalent to TCAGTTCTTGAGAACCGCTC, GCAGACGTGTTAGCAAGATC, GTCGGCTGTCACGGGTGAAT and GCCGCTCAGTCGGCTGTCAC), resulting in a 292 bp deletion that includes exon 5 (ENSMUSE00001205218; GRCm39), leading to a frameshift and premature stop codon. (J:358405)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Paxbp1 Mutation:  46 strains or lines available
References
Original:  J:358405 MGI and ICS/MCI, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC) Generated by ICS/MCI. Database Release. 2024;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory