Rr431^em1Dasp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr431^em1Dasp
• Name: regulatory region 431; endonuclease-mediated mutation 1, David S Park
• MGI ID: MGI:7778443
• Synonyms: Nkx2-5^deltaenh
• Gene: Rr431 Location: unknown Genetic Position: Chr17, Syntenic
• Alliance: Rr431^em1Dasp page

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intergenic deletion
• Mutation details: The Nkx2-5 embryonic cardiac (anterior second heart field) enhancer, located upstream of the gene, was targeted using sgRNAs (equivalent to GATTACTTTATCTTCCCCGG and GGGACATCTTTTGTCTCT) with CRISPR/Cas9 technology, resulting in a 229 bp deletion (GRCm39:chr17:27069762-27069990). (J:353441)

Expression

In Mice Carrying this Mutation:

1 RNA-Seq or microarray experiment(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr431 Mutation: 0 strains or lines available

References

• Original: J:353441 Yamaguchi N, et al., An Anterior Second Heart Field Enhancer Regulates the Gene Regulatory Network of the Cardiac Outflow Tract. Circulation. 2023 Nov 21;148(21):1705-1722
• All: 1 reference(s)