Rr60913^em1Gan
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr60913^em1Gan
• Name: regulatory region 60913; endonuclease-mediated mutation 1, Lin Gan
• MGI ID: MGI:7768149
• Synonyms: Ntng2 enhancer -24
• Gene: Rr60913 Location: Chr2:29161202-29163199 bp Genetic Position: Chr2, Syntenic
• Alliance: Rr60913^em1Gan page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intergenic deletion
• Mutation details: The proximal Ntng2 enhancer was targeted using sgRNAs (equivalent to ACCTGCCTGTGTCCTTGTGT and GTCATCTTGAAGATACCAGA) with CRISPR/Cas9 technology, resulting in an 805 bp deletion (GRCm39:chr2:29162169-29162973). (J:354180)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr60913 Mutation: 0 strains or lines available

References

• Original: J:354180 Xu M, et al., ISL1 and POU4F1 Directly Interact to Regulate the Differentiation and Survival of Inner Ear Sensory Neurons. J Neurosci. 2024 Feb 21;44(8)
• All: 1 reference(s)