About   Help   FAQ
Crlf2em1.1Ics
Endonuclease-mediated Allele Detail
Summary
Symbol: Crlf2em1.1Ics
Name: cytokine receptor-like factor 2; endonuclease-mediated mutation 1.1, Mouse Clinical Institute
MGI ID: MGI:7768074
Synonyms: Crlf2L2
Gene: Crlf2  Location: Chr5:109702575-109706859 bp, - strand  Genetic Position: Chr5, 53.24 cM
Alliance: Crlf2em1.1Ics page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Mutation
description
Allele Type:    Endonuclease-mediated (Conditional ready)
Mutation:    Insertion
 
Mutation detailsUsing an sgRNA (equivalent to TTTTAAACGCCTGAAAGAGT) with CRISPR/Cas9 technology, a loxP site and an FRT site flanked neomycin resistance gene cassette were inserted into intron 2 and a second loxP site into intron 3. The neo cassette was removed through subsequent Cre-mediated recombination, leaving a conditional-ready allele with exon 3 floxed. (J:331385)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Crlf2 Mutation:  23 strains or lines available
References
Original:  J:331385 Yao W, et al., Keratinocyte-derived cytokine TSLP promotes growth and metastasis of melanoma by regulating the tumor-associated immune microenvironment. JCI Insight. 2022 Nov 8;7(21)
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory