Crlf2^em1.1Ics
Endonuclease-mediated Allele Detail

Summary

• Symbol: Crlf2^em1.1Ics
• Name: cytokine receptor-like factor 2; endonuclease-mediated mutation 1.1, Mouse Clinical Institute
• MGI ID: MGI:7768074
• Synonyms: Crlf2^L2
• Gene: Crlf2 Location: Chr5:109702575-109706859 bp, - strand Genetic Position: Chr5, 53.24 cM
• Alliance: Crlf2^em1.1Ics page

Mutation origin

• Strain of Origin: C57BL/6NCrl

Mutation description

• Allele Type: Endonuclease-mediated (Conditional ready)
• Mutation: Insertion
• Mutation details: Using an sgRNA (equivalent to TTTTAAACGCCTGAAAGAGT) with CRISPR/Cas9 technology, a loxP site and an FRT site flanked neomycin resistance gene cassette were inserted into intron 2 and a second loxP site into intron 3. The neo cassette was removed through subsequent Cre-mediated recombination, leaving a conditional-ready allele with exon 3 floxed. (J:331385)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Crlf2 Mutation: 24 strains or lines available

References

• Original: J:331385 Yao W, et al., Keratinocyte-derived cytokine TSLP promotes growth and metastasis of melanoma by regulating the tumor-associated immune microenvironment. JCI Insight. 2022 Nov 8;7(21)
• All: 1 reference(s)