About   Help   FAQ
2510039O18Rikem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: 2510039O18Rikem1(IMPC)J
Name: RIKEN cDNA 2510039O18 gene; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7768064
Gene: 2510039O18Rik  Location: Chr4:148025352-148031771 bp, + strand  Genetic Position: Chr4, 78.57 cM, cytoband E1
Alliance: 2510039O18Rikem1(IMPC)J page
IMPC: 2510039O18Rik gene page
Mutation
origin
Strain of Origin:  Not Applicable
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: GTTGGGCGGCGGGCCCGATG and GTGGCCGAGAGCAGGACTCG. This resulted in a 5,722 bp deletion of Chr4:147,940,909-147,946,630 (GRCm38/mm10) that removes exons ENSMUSE00000334978, ENSMUSE00000661657 and ENSMUSE00000661656. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any 2510039O18Rik Mutation:  20 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory