Gm39266^em3Kmm
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gm39266^em3Kmm
• Name: predicted gene, 39266; endonuclease-mediated mutation 3, Kenneth M Murphy
• MGI ID: MGI:7767853
• Synonyms: Gm39266 pA
• Gene: Gm39266 Location: Chr8:121494202-121495865 bp, - strand Genetic Position: Chr8, Syntenic
• Alliance: Gm39266^em3Kmm page

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Insertion
• Mutation details: A triple poly(A) signal cassette (synthetic + SV40 + mouse Pgk1) was inserted into intron 2 between exon 2 and Irf8 enhancer Rr172 using an sgRNA (equivalent to GGTAAGAAATCCTACCTCTG) and an ssODN template with CRISPR/Cas9 technology. (J:355425)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Gm39266 Mutation: 0 strains or lines available

References

• Original: J:355425 Liu TT, et al., Cis interactions in the Irf8 locus regulate stage-dependent enhancer activation. Genes Dev. 2023 Apr 1;37(7-8):291-302
• All: 1 reference(s)