Gm39266^em1Kmm
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gm39266^em1Kmm
• Name: predicted gene, 39266; endonuclease-mediated mutation 1, Kenneth M Murphy
• MGI ID: MGI:7767851
• Synonyms: s-pro^-
• Gene: Gm39266 Location: Chr8:121494202-121495865 bp, - strand Genetic Position: Chr8, Syntenic
• Alliance: Gm39266^em1Kmm page

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Modified isoform(s))
• Mutation: Intragenic deletion
• Mutation details: Exon 2, and the promoter upstream of it, was targeted using two sgRNAs (equivalent to CAGGCACAGTCTGGGTACAC and GGTAAGAAATCCTACCTCTG) with CRISPR/Cas9 technology, resulting in a deletion. (J:355425)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Gm39266 Mutation: 0 strains or lines available

References

• Original: J:355425 Liu TT, et al., Cis interactions in the Irf8 locus regulate stage-dependent enhancer activation. Genes Dev. 2023 Apr 1;37(7-8):291-302
• All: 1 reference(s)