Cbr1b^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cbr1b^em1(IMPC)J
• Name: carbonyl reductase 1B; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7763981
• Gene: Cbr1b Location: Chr16:93424985-93427339 bp, + strand Genetic Position: Chr16, 54.54 cM
• Alliance: Cbr1b^em1(IMPC)J page
• IMPC: Cbr1b gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: GACATGGCTGCGTGTTCCTA and CAGCAAGTCTGGATATAAGG. This resulted in a 2,287 bp deletion of Chr16:93,628,085-93,630,371 (GRCm38/mm10) that removes exons ENSMUSE00000720738, ENSMUSE00001039070 and ENSMUSE00000714002. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Cbr1b Mutation: 5 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)