About   Help   FAQ
Nanos2em1Lmjn
Endonuclease-mediated Allele Detail
Summary
Symbol: Nanos2em1Lmjn
Name: nanos C2HC-type zinc finger 2; endonuclease-mediated mutation 1, Lauryl Nutter
MGI ID: MGI:7751128
Gene: Nanos2  Location: Chr7:18721449-18722887 bp, + strand  Genetic Position: Chr7, 9.45 cM
Alliance: Nanos2em1Lmjn page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Conditional ready, No functional change)
Mutation:    Insertion
 
Mutation detailsThis allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with a guide RNA with the spacer sequence GACATCCAGGGTAGCCCTCC and a single-stranded DNA repair template to insert a Short Conditional intrON (SCON) into the Nanos2 coding region. This resulting allele has an artificial intron inserted after Chr7:18721673. Cre excision is predicted to generate a null allele. (J:345353)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Nanos2 Mutation:  16 strains or lines available
References
Original:  J:345353 Nutter L, Direct Data Submissions for Lauryl Nutter. 2024;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory