Nanos2^em1Lmjn
Endonuclease-mediated Allele Detail

Summary

• Symbol: Nanos2^em1Lmjn
• Name: nanos C2HC-type zinc finger 2; endonuclease-mediated mutation 1, Lauryl Nutter
• MGI ID: MGI:7751128
• Gene: Nanos2 Location: Chr7:18721449-18722887 bp, + strand Genetic Position: Chr7, 9.45 cM
• Alliance: Nanos2^em1Lmjn page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Conditional ready, No functional change)
• Mutation: Insertion
• Mutation details: This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with a guide RNA with the spacer sequence GACATCCAGGGTAGCCCTCC and a single-stranded DNA repair template to insert a Short Conditional intrON (SCON) into the Nanos2 coding region. This resulting allele has an artificial intron inserted after Chr7:18721673. Cre excision is predicted to generate a null allele. (J:345353)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Nanos2 Mutation: 16 strains or lines available

References

• Original: J:345353 Nutter L, Direct Data Submissions for Lauryl Nutter. 2024
• All: 1 reference(s)