About   Help   FAQ
Spmip1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Spmip1em1(IMPC)J
Name: sperm microtubule inner protein 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7750817
Gene: Spmip1  Location: Chr6:29471436-29473428 bp, + strand  Genetic Position: Chr6, 12.36 cM
Alliance: Spmip1em1(IMPC)J page
IMPC: Spmip1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: GTTGAGCTGCCTCGACATGG and CTCAGAGGGCCAGATCTCGA. This resulted in a 1,875 bp deletion of Chr6:29,471,525-29,473,399 (GRCm38/mm10) that removes exons ENSMUSE00000898298 and ENSMUSE00000890596. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Spmip1 Mutation:  5 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory