Rr557^em2Dean
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr557^em2Dean
• Name: regulatory region 557; endonuclease-mediated mutation 2, Jurrien Dean
• MGI ID: MGI:7730911
• Synonyms: delta813, Rr557^em2Jdean
• Gene: Rr557 Location: Chr1:149964767-149965404 bp Genetic Position: Chr1, Syntenic
• Alliance: Rr557^em2Dean page

Mutation origin

• Strain of Origin: C57LB/6

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intragenic deletion
• Mutation details: The Ptgs2 enhancer, located upstream in a Ptgs2os intron, was targeted using crRNAs (equivalent to GTGAAGTGGCCCTGGCGTCATGG and ATATTGTGTTCGATTCTACAAGG) with CRISPR/Cas9 technology, resulting in an 813 bp deletion (GRCm39:chr1:149964766-149965578). (J:341141)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr557 Mutation: 0 strains or lines available

References

• Original: J:341141 Xin Q, et al., Chromatin remodeling of prostaglandin signaling in smooth muscle enables mouse embryo passage through the female reproductive tract. Dev Cell. 2023 Sep 25;58(18):1716-1732.e8
• All: 1 reference(s)