Rr557em2Dean
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Rr557em2Dean |
| Name: |
regulatory region 557; endonuclease-mediated mutation 2, Jurrien Dean |
| MGI ID: |
MGI:7730911 |
| Synonyms: |
delta813, Rr557em2Jdean |
| Gene: |
Rr557 Location: Chr1:149964767-149965404 bp Genetic Position: Chr1, Syntenic
|
| Alliance: |
Rr557em2Dean page
|
|
| Strain of Origin: |
C57LB/6
|
|
| Allele Type: |
|
Endonuclease-mediated (Modified regulatory region) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: The Ptgs2 enhancer, located upstream in a Ptgs2os intron, was targeted using crRNAs (equivalent to GTGAAGTGGCCCTGGCGTCATGG and ATATTGTGTTCGATTCTACAAGG) with CRISPR/Cas9 technology, resulting in an 813 bp deletion (GRCm39:chr1:149964766-149965578).
(J:341141)
|
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Rr557 Mutation: |
0 strains or lines available
|
|
| Original: |
J:341141 Xin Q, et al., Chromatin remodeling of prostaglandin signaling in smooth muscle enables mouse embryo passage through the female reproductive tract. Dev Cell. 2023 Sep 25;58(18):1716-1732.e8 |
| All: |
1 reference(s) |
|