About   Help   FAQ
Rr556em1Zkoz
Endonuclease-mediated Allele Detail
Summary
Symbol: Rr556em1Zkoz
Name: regulatory region 556; endonuclease-mediated mutation 1, Zbynek Kozmik
MGI ID: MGI:7720867
Synonyms: TdeltaI
Gene: Rr556  Location: Chr17:8666620-8666981 bp  Genetic Position: Chr17, Syntenic
Alliance: Rr556em1Zkoz page
Mutation
origin
Strain of Origin:  C57BL/6N
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Intergenic deletion
 
Mutation detailsBrachyury enhancer I was targeted using crRNAs/tracrRNAs (targeting AAAGGTCACCGCTATGGTGT and ACACTACAAACAGCGCTTAC) with CRISPR/Cas9 technology, resulting in a 1106 bp deletion (GRCm39:chr17:8666208-8667313) and a two-nucleotide mutation (g.chr17:8667316-8667317GG>AC). (J:341678)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rr556 Mutation:  0 strains or lines available
References
Original:  J:341678 Kemmler CL, et al., Conserved enhancers control notochord expression of vertebrate Brachyury. Nat Commun. 2023 Oct 18;14(1):6594
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory