Rr556em1Zkoz
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Rr556em1Zkoz |
| Name: |
regulatory region 556; endonuclease-mediated mutation 1, Zbynek Kozmik |
| MGI ID: |
MGI:7720867 |
| Synonyms: |
TdeltaI |
| Gene: |
Rr556 Location: Chr17:8666620-8666981 bp Genetic Position: Chr17, Syntenic
|
| Alliance: |
Rr556em1Zkoz page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Modified regulatory region) |
| Mutation: |
|
Intergenic deletion
|
| |
|
Mutation details: Brachyury enhancer I was targeted using crRNAs/tracrRNAs (targeting AAAGGTCACCGCTATGGTGT and ACACTACAAACAGCGCTTAC) with CRISPR/Cas9 technology, resulting in a 1106 bp deletion (GRCm39:chr17:8666208-8667313) and a two-nucleotide mutation (g.chr17:8667316-8667317GG>AC).
(J:341678)
|
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Rr556 Mutation: |
0 strains or lines available
|
|
| Original: |
J:341678 Kemmler CL, et al., Conserved enhancers control notochord expression of vertebrate Brachyury. Nat Commun. 2023 Oct 18;14(1):6594 |
| All: |
1 reference(s) |
|