Bltp3a^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Bltp3a^em1(IMPC)J
• Name: bridge-like lipid transfer protein family member 3A; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7720840
• Gene: Bltp3a Location: Chr17:28075481-28119014 bp, + strand Genetic Position: Chr17, 14.59 cM
• Alliance: Bltp3a^em1(IMPC)J page
• IMPC: Bltp3a gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: CCCCAACCAAAAATTTAGGG and TGGTTAGCCCGGATTTGTGC. This resulted in a 1,277 bp deletion of Chr17:27,879,102-27,880,378 (GRCm38/mm10) that removes exons ENSMUSE00001293900 through ENSMUSE00000449238. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Bltp3a Mutation: 70 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)