Tubgcp5^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tubgcp5^em1(IMPC)J
• Name: tubulin, gamma complex component 5; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7719856
• Gene: Tubgcp5 Location: Chr7:55443873-55481207 bp, + strand Genetic Position: Chr7, 33.42 cM
• Alliance: Tubgcp5^em1(IMPC)J page
• IMPC: Tubgcp5 gene page

Mutation origin

• Strain of Origin: Not Applicable
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: TCTTACACTTGTTAGAACTA and GATTTCTCACAGGAGGTCTC. This resulted in a 2,192 bp deletion of Chr7:55,798,614-55,800,805 (GRCm38/mm10) that removes exons ENSMUSE00001057379 through ENSMUSE00001055038. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Tubgcp5 Mutation: 56 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)