Rr549em1Pero
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Rr549em1Pero |
| Name: |
regulatory region 549; endonuclease-mediated mutation 1, Pedro P Rocha |
| MGI ID: |
MGI:7716897 |
| Synonyms: |
SCRdelta |
| Gene: |
Rr549 Location: Chr3:34806891-34820933 bp Genetic Position: Chr3, Syntenic
|
| Alliance: |
Rr549em1Pero page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Modified regulatory region) |
| Mutation: |
|
Intergenic deletion
|
| |
|
Mutation details: The Sox2 distal super-enhancer SCR, containing enhancers Rr553 and others, was targeted using sgRNAs (equivalent to TATATATGGGGTGGTTTATC and CGGGCAATGAGATAGCTTAC) with CRISPR/Cas9 technology, resulting in a 14,043 bp deletion (GRCm39:chr3:34806891-34820933).
(J:342647)
|
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Rr549 Mutation: |
0 strains or lines available
|
|
| Original: |
J:342647 Chakraborty S, et al., Enhancer-promoter interactions can bypass CTCF-mediated boundaries and contribute to phenotypic robustness. Nat Genet. 2023 Feb;55(2):280-290 |
| All: |
1 reference(s) |
|