About   Help   FAQ
Rr549em1Pero
Endonuclease-mediated Allele Detail
Summary
Symbol: Rr549em1Pero
Name: regulatory region 549; endonuclease-mediated mutation 1, Pedro P Rocha
MGI ID: MGI:7716897
Synonyms: SCRdelta
Gene: Rr549  Location: Chr3:34806891-34820933 bp  Genetic Position: Chr3, Syntenic
Alliance: Rr549em1Pero page
Mutation
origin
Strain of Origin:  C57BL/6NCr
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Intergenic deletion
 
Mutation detailsThe Sox2 distal super-enhancer SCR, containing enhancers Rr553 and others, was targeted using sgRNAs (equivalent to TATATATGGGGTGGTTTATC and CGGGCAATGAGATAGCTTAC) with CRISPR/Cas9 technology, resulting in a 14,043 bp deletion (GRCm39:chr3:34806891-34820933). (J:342647)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rr549 Mutation:  0 strains or lines available
References
Original:  J:342647 Chakraborty S, et al., Enhancer-promoter interactions can bypass CTCF-mediated boundaries and contribute to phenotypic robustness. Nat Genet. 2023 Feb;55(2):280-290
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory