Rr549^em1Pero
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr549^em1Pero
• Name: regulatory region 549; endonuclease-mediated mutation 1, Pedro P Rocha
• MGI ID: MGI:7716897
• Synonyms: SCRdelta
• Gene: Rr549 Location: Chr3:34806891-34820933 bp Genetic Position: Chr3, Syntenic
• Alliance: Rr549^em1Pero page

Mutation origin

• Strain of Origin: C57BL/6NCr

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intergenic deletion
• Mutation details: The Sox2 distal super-enhancer SCR, containing enhancers Rr553 and others, was targeted using sgRNAs (equivalent to TATATATGGGGTGGTTTATC and CGGGCAATGAGATAGCTTAC) with CRISPR/Cas9 technology, resulting in a 14,043 bp deletion (GRCm39:chr3:34806891-34820933). (J:342647)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr549 Mutation: 0 strains or lines available

References

• Original: J:342647 Chakraborty S, et al., Enhancer-promoter interactions can bypass CTCF-mediated boundaries and contribute to phenotypic robustness. Nat Genet. 2023 Feb;55(2):280-290
• All: 1 reference(s)