About   Help   FAQ
Rr547em1Gova
Endonuclease-mediated Allele Detail
Summary
Symbol: Rr547em1Gova
Name: regulatory region 547; endonuclease-mediated mutation 1, Golnaz Vahedi
MGI ID: MGI:7716472
Synonyms: Ets1-SE-
Gene: Rr547  Location: Chr9:32815365-32840262 bp  Genetic Position: Chr9, Syntenic
Alliance: Rr547em1Gova page
Mutation
origin
Strain of Origin:  Not Applicable
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutations:    Intergenic deletion, Intragenic deletion
 
Mutation detailsThe Ets1 super-enhancer, overlapping lncRNA Gm27162, was targeted using sgRNAs (equivalent to GGACGTTGTGCACCTAGGATTGG and ATAAACGTCAATAATGGTATAGG) with CRISPR/Cas9 technology, resulting in its deletion. (J:342767)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rr547 Mutation:  0 strains or lines available
References
Original:  J:342767 Chandra A, et al., Quantitative control of Ets1 dosage by a multi-enhancer hub promotes Th1 cell differentiation and protects from allergic inflammation. Immunity. 2023 Jul 11;56(7):1451-1467.e12
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/13/2026
MGI 6.24
The Jackson Laboratory