Rr547^em1Gova
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr547^em1Gova
• Name: regulatory region 547; endonuclease-mediated mutation 1, Golnaz Vahedi
• MGI ID: MGI:7716472
• Synonyms: Ets1-SE^-
• Gene: Rr547 Location: Chr9:32815365-32840262 bp Genetic Position: Chr9, Syntenic
• Alliance: Rr547^em1Gova page

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutations: Intergenic deletion, Intragenic deletion
• Mutation details: The Ets1 super-enhancer, overlapping lncRNA Gm27162, was targeted using sgRNAs (equivalent to GGACGTTGTGCACCTAGGATTGG and ATAAACGTCAATAATGGTATAGG) with CRISPR/Cas9 technology, resulting in its deletion. (J:342767)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr547 Mutation: 0 strains or lines available

References

• Original: J:342767 Chandra A, et al., Quantitative control of Ets1 dosage by a multi-enhancer hub promotes Th1 cell differentiation and protects from allergic inflammation. Immunity. 2023 Jul 11;56(7):1451-1467.e12
• All: 1 reference(s)