About   Help   FAQ
LxMm-9c11em1Ceki
Endonuclease-mediated Allele Detail
Summary
Symbol: LxMm-9c11em1Ceki
Name: LINE repeat x, subfamily 9, member c11; endonuclease-mediated mutation 1, Cecile King
MGI ID: MGI:7715162
Synonyms: Lx9c11-
Gene: LxMm-9c11  Location: Chr11:83006353-83006537 bp  Genetic Position: Chr11, Syntenic
Alliance: LxMm-9c11em1Ceki page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Not Applicable)
Mutation:    Intergenic deletion
 
Mutation detailsThe ancient rodent LINE repeat, located between Slfn2 and Slfn1, was targeted using sgRNAs (equivalent to GTATGAATGCTTTACTTATGTGG and TGCCTAGCATCTCACCTCTATGG) with CRISPR/Cas9 technology, resulting in a 162 bp deletion (GRCm39:chr11:83006359-83006520). (J:342772)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any LxMm-9c11 Mutation:  0 strains or lines available
References
Original:  J:342772 Bartonicek N, et al., The retroelement Lx9 puts a brake on the immune response to virus infection. Nature. 2022 Aug;608(7924):757-765
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory