LxMm-9c11^em1Ceki
Endonuclease-mediated Allele Detail

Summary

• Symbol: LxMm-9c11^em1Ceki
• Name: LINE repeat x, subfamily 9, member c11; endonuclease-mediated mutation 1, Cecile King
• MGI ID: MGI:7715162
• Synonyms: Lx9c11^-
• Gene: LxMm-9c11 Location: Chr11:83006353-83006537 bp Genetic Position: Chr11, Syntenic
• Alliance: LxMm-9c11^em1Ceki page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Intergenic deletion
• Mutation details: The ancient rodent LINE repeat, located between Slfn2 and Slfn1, was targeted using sgRNAs (equivalent to GTATGAATGCTTTACTTATGTGG and TGCCTAGCATCTCACCTCTATGG) with CRISPR/Cas9 technology, resulting in a 162 bp deletion (GRCm39:chr11:83006359-83006520). (J:342772)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any LxMm-9c11 Mutation: 0 strains or lines available

References

• Original: J:342772 Bartonicek N, et al., The retroelement Lx9 puts a brake on the immune response to virus infection. Nature. 2022 Aug;608(7924):757-765
• All: 1 reference(s)