About   Help   FAQ
Tg(Taar4-Venus)HD2Tboz
Transgene Detail
Summary
Symbol: Tg(Taar4-Venus)HD2Tboz
Name: transgene insertion HD2, Thomas Bozza
MGI ID: MGI:7714927
Synonyms: 5xHD-deltaT4YFPtg
Transgene: Tg(Taar4-Venus)HD2Tboz  Location: unknown  
Alliance: Tg(Taar4-Venus)HD2Tboz page
Transgene
origin
Strain of Origin:  C57BL/6J
Transgene
description
Transgene Type:    Transgenic (Reporter)
Mutation:    Insertion
 
Mutation detailsThe transgene contains the following elements: ~2.3 kb sequence from upstream of the Taar4 TSS with 5 copies of homeodomain sequence ACATAACTTTTTAATGAGTCT inserted ~2 kb upstream of the TSS, the 5' UTR exons and intron, the Venus reporter gene (including Kozak sequence GCCACCATG upstream; replaces Taar4 CDS) and 1.3 kb sequence from downstream of the Taar4 CDS. (J:343906)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
References
Original:  J:343906 Shah A, et al., Olfactory expression of trace amine-associated receptors requires cooperative cis-acting enhancers. Nat Commun. 2021 Jun 18;12(1):3797
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory