Rr541^em1Dean
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr541^em1Dean
• Name: regulatory region 541; endonuclease-mediated mutation 1, Jurrien Dean
• MGI ID: MGI:7713368
• Synonyms: Rr541^em1Jdean
• Gene: Rr541 Location: Chr8:57765522-57766564 bp Genetic Position: Chr8, Syntenic
• Alliance: Rr541^em1Dean page

Mutation origin

• Strain of Origin: C57LB/6

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intragenic deletion
• Mutation details: The uterine stromal Hand2 enhancer (located in an intron of the Hand2-os1 lncRNA gene) was targeted using sgRNAs (equivalent to CGCTGAGAGCCCTTTGCACA, TTGCACAGGGGTTTGGGCTA, AATAATTATTGAGCGCAGCT and ATTGAGCGCAGCTTGGTATC) with CRISPR/Cas9 technology, resulting in a 1017 bp deletion (GRCm39:chr8:57765552-57766568). (J:345636)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr541 Mutation: 0 strains or lines available

References

• Original: J:345636 Xin Q, et al., Stromal Pbrm1 mediates chromatin remodeling necessary for embryo implantation in the mouse uterus. J Clin Invest. 2024 Mar 1;134(5)
• All: 1 reference(s)