About   Help   FAQ
Rr516em1Okud
Endonuclease-mediated Allele Detail
Summary
Symbol: Rr516em1Okud
Name: regulatory region 509; endonuclease-mediated mutation 1, Akihiko Okuda
MGI ID: MGI:7711993
Synonyms: dMUR
Gene: Rr516  Location: Chr12:77011732-77013321 bp  Genetic Position: Chr12, Syntenic
Alliance: Rr516em1Okud page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Intergenic deletion
 
Mutation detailsMax enhancer MUR, located upstream, was targeted using sgRNAs (equivalent to CCCACTGAAACATCGCCCCATGG and TCTTCACAGGCTAAGATCTCAGG) with CRISPR/Cas9 technology, resulting in an ~1.6 kb deletion. (J:345877)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Rr516 Mutation:  1 strain or line available
References
Original:  J:345877 Suzuki A, et al., MAX controls meiotic entry in sexually undifferentiated germ cells. Sci Rep. 2024 Mar 4;14(1):5236
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory