Rr516^em1Okud
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr516^em1Okud
• Name: regulatory region 509; endonuclease-mediated mutation 1, Akihiko Okuda
• MGI ID: MGI:7711993
• Synonyms: dMUR
• Gene: Rr516 Location: Chr12:77011732-77013321 bp Genetic Position: Chr12, Syntenic
• Alliance: Rr516^em1Okud page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intergenic deletion
• Mutation details: Max enhancer MUR, located upstream, was targeted using sgRNAs (equivalent to CCCACTGAAACATCGCCCCATGG and TCTTCACAGGCTAAGATCTCAGG) with CRISPR/Cas9 technology, resulting in an ~1.6 kb deletion. (J:345877)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr516 Mutation: 0 strains or lines available

References

• Original: J:345877 Suzuki A, et al., MAX controls meiotic entry in sexually undifferentiated germ cells. Sci Rep. 2024 Mar 4;14(1):5236
• All: 1 reference(s)