Gt(ROSA)26Sorem2(CAG-GFP,-Farsa*T413G)Msasn
Endonuclease-mediated Allele Detail
|
Symbol: |
Gt(ROSA)26Sorem2(CAG-GFP,-Farsa*T413G)Msasn |
Name: |
gene trap ROSA 26, Philippe Soriano; endonuclease-mediated mutation 2, Michael Sasner |
MGI ID: |
MGI:7711614 |
Gene: |
Gt(ROSA)26Sor Location: Chr6:113044389-113054205 bp, - strand Genetic Position: Chr6, 52.73 cM
|
Alliance: |
Gt(ROSA)26Sorem2(CAG-GFP,-Farsa*T413G)Msasn page
|
|
|
Allele Type: |
|
Endonuclease-mediated (Conditional ready, Inserted expressed sequence, Reporter) |
Mutation: |
|
Insertion
|
|
|
Gt(ROSA)26Sorem2(CAG-GFP,-Farsa*T413G)Msasn expresses
1 gene
|
|
|
Mutation details: sgRNAs (ACTGGAGTTGCAGATCACGA and GCAGATCACGAGGGAAGAGG) were designed to insert a cassette encoding a CMV-IE enhancer/chicken beta-actin/rabbit beta-globin hybrid promoter (CAG) followed by a floxed STOP cassette containing 3xSV40 polyadenlyation signals, an EGFP sequence, a viral 2A oligopeptide (P2A) self-cleaving peptide, that mediates ribosomal skipping, and a mutant phenylalanyl-tRNA synthetase, alpha subunit (Farsa) gene into the Gt(ROSA)26Sor locus. The Farsa gene contains a threonine to glycine mutation at amino acid 413 (T413G).
(J:101977)
|
|
|
|
Original: |
J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017; |
All: |
1 reference(s) |
|