Rr213028^em1Hayus
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr213028^em1Hayus
• Name: regulatory region 213028; endonuclease-mediated mutation 1, Han-Yu Shih
• MGI ID: MGI:7710909
• Synonyms: CBS-70delta
• Gene: Rr213028 Location: Chr10:118206401-118206800 bp Genetic Position: Chr10, Syntenic
• Alliance: Rr213028^em1Hayus page

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intergenic deletion
• Mutation details: The CTCF-binding site, between the Il22 and the Ifng topologically associating domains (TADs), was targeted with an sgRNA (equivalent to GCTAGTATGTGGCCACAAGA) using CRISPR/Cas9 technology, resulting in a 17 bp deletion (GRCm39:chr10:118206543-118206559). (J:349452)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr213028 Mutation: 0 strains or lines available

References

• Original: J:349452 Liu C, et al., A CTCF-binding site in the Mdm1-Il22-Ifng locus shapes cytokine expression profiles and plays a critical role in early Th1 cell fate specification. Immunity. 2024 May 14;57(5):1005-1018.e7
• All: 1 reference(s)