About   Help   FAQ
Rr213028em1Hayus
Endonuclease-mediated Allele Detail
Summary
Symbol: Rr213028em1Hayus
Name: regulatory region 213028; endonuclease-mediated mutation 1, Han-Yu Shih
MGI ID: MGI:7710909
Synonyms: CBS-70delta
Gene: Rr213028  Location: Chr10:118206401-118206800 bp  Genetic Position: Chr10, Syntenic
Alliance: Rr213028em1Hayus page
Mutation
origin
Strain of Origin:  Not Applicable
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Intergenic deletion
 
Mutation detailsThe CTCF-binding site, between the Il22 and the Ifng topologically associating domains (TADs), was targeted with an sgRNA (equivalent to GCTAGTATGTGGCCACAAGA) using CRISPR/Cas9 technology, resulting in a 17 bp deletion (GRCm39:chr10:118206543-118206559). (J:349452)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rr213028 Mutation:  0 strains or lines available
References
Original:  J:349452 Liu C, et al., A CTCF-binding site in the Mdm1-Il22-Ifng locus shapes cytokine expression profiles and plays a critical role in early Th1 cell fate specification. Immunity. 2024 May 14;57(5):1005-1018.e7
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory