Rr499^em5Jejo
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr499^em5Jejo
• Name: regulatory region 499; endonuclease-mediated mutation 5, Jane E Johnson
• MGI ID: MGI:7705118
• Synonyms: Ptf1a^AR4
• Gene: Rr499 Location: Chr2:19434901-19437198 bp Genetic Position: Chr2, Syntenic
• Alliance: Rr499^em5Jejo page

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutations: Insertion, Intergenic deletion, Nucleotide substitutions
• Mutation details: The Ptf1a 5' enhancer was targeted by three sgRNAs (equivalent to CACAAGTGGCGACATTCCCA, ATAACACATGTGCTGGGGCG and CCGCAGAGCACGCCAGTCCG) and two ssODN templates using CRISPR/Cas9 technology, resulting in mutations in the E-box of the near and in the TC-box of the far autoregulatory PTF1-binding motif (GRCm39:chr2:19435683-19435686) replaced with CCAT and chr2:19436904-19436909 replaced with GATATCTTATGA. (J:297165)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr499 Mutation: 0 strains or lines available

References

• Original: J:297165 Mona B, et al., Positive autofeedback regulation of Ptf1a transcription generates the levels of PTF1A required to generate itch circuit neurons. Genes Dev. 2020 May 1;34(9-10):621-636
• All: 1 reference(s)