About   Help   FAQ
Rr112510em1Andg
Endonuclease-mediated Allele Detail
Summary
Symbol: Rr112510em1Andg
Name: regulatory region 112510; endonuclease-mediated mutation 1, Guillaume Andrey
MGI ID: MGI:7703761
Synonyms: deltaCTCF i4
Gene: Rr112510  Location: Chr5:29540801-29541200 bp  Genetic Position: Chr5, Syntenic
Alliance: Rr112510em1Andg page
Mutation
origin
Germline Transmission:  Earliest citation of germline transmission: J:276559
Parent Cell Line:  G4 (ES Cell)
Strain of Origin:  (129S6/SvEvTac x C57BL/6NCrl)F1
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Intragenic deletion
 
Mutation detailsThe CTCF-binding site, located in Lmbr1 intron 4, was deleted using an sgRNA with CRISPR/Cas9 technology. This allele represents two different deletions (CTGCTGGTATCAC on one copy of chromosome 5 and TCTTCTACTGCCACCTGCTGGTAT on the other) that overlap the binding site CTGCCACCTGCTGGTATCA. (J:276559)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rr112510 Mutation:  0 strains or lines available
References
Original:  J:276559 Paliou C, et al., Preformed chromatin topology assists transcriptional robustness of Shh during limb development. Proc Natl Acad Sci U S A. 2019 Jun 18;116(25):12390-12399
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory