Rr112510em1Andg
Endonuclease-mediated Allele Detail
|
Symbol: |
Rr112510em1Andg |
Name: |
regulatory region 112510; endonuclease-mediated mutation 1, Guillaume Andrey |
MGI ID: |
MGI:7703761 |
Synonyms: |
deltaCTCF i4 |
Gene: |
Rr112510 Location: Chr5:29540801-29541200 bp Genetic Position: Chr5, Syntenic
|
Alliance: |
Rr112510em1Andg page
|
|
|
Allele Type: |
|
Endonuclease-mediated (Modified regulatory region) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: The CTCF-binding site, located in Lmbr1 intron 4, was deleted using an sgRNA with CRISPR/Cas9 technology. This allele represents two different deletions (CTGCTGGTATCAC on one copy of chromosome 5 and TCTTCTACTGCCACCTGCTGGTAT on the other) that overlap the binding site CTGCCACCTGCTGGTATCA.
(J:276559)
|
|
|
Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
Carrying any Rr112510 Mutation: |
0 strains or lines available
|
|
Original: |
J:276559 Paliou C, et al., Preformed chromatin topology assists transcriptional robustness of Shh during limb development. Proc Natl Acad Sci U S A. 2019 Jun 18;116(25):12390-12399 |
All: |
1 reference(s) |
|