Aqp4^em2Jdd
Endonuclease-mediated Allele Detail

Summary

• Symbol: Aqp4^em2Jdd
• Name: aquaporin 4; endonuclease-mediated mutation 2, Joseph D Dougherty
• MGI ID: MGI:7703300
• Synonyms: AllX
• Gene: Aqp4 Location: Chr18:15522553-15544039 bp, - strand Genetic Position: Chr18, 8.74 cM
• Alliance: Aqp4^em2Jdd page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Modified isoform(s))
• Mutation: Nucleotide substitutions
• Mutation details: Using CRISPR/cas9 endonuclease-mediated genome editing, a guide RNA (ATTGTCTTCCGTATGACTAG) was used to insert a TGA-to-TGG mutation, resulting in a stop codon to sense codon, in the aquaporin 4 (Aqp4) gene. Conversion of canonical stop codons to a sense codon results in stop codon readthrough events generating a conserved C-terminally elongated variant of Aquaporin 4 (AQP4X). (J:351558)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Aqp4 Mutation: 45 strains or lines available

References

• Original: J:351558 Mueller SM, et al., Evaluation of gliovascular functions of Aqp4 readthrough isoforms. bioRxiv. 2023 Jul 25
• All: 1 reference(s)