Aqp4^em1Jdd
Endonuclease-mediated Allele Detail

Summary

• Symbol: Aqp4^em1Jdd
• Name: aquaporin 4; endonuclease-mediated mutation 1, Joseph D Dougherty
• MGI ID: MGI:7703298
• Synonyms: Aqp4^No_X
• Gene: Aqp4 Location: Chr18:15522553-15544039 bp, - strand Genetic Position: Chr18, 8.74 cM
• Alliance: Aqp4^em1Jdd page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (No functional change)
• Mutation: Nucleotide substitutions
• Mutation details: Using CRISPR/cas9 endonuclease-mediated genome editing. A guide RNA (ATTGTCTTCCGTATGACTAG) was used to insert two additional stop codon sequences in the frame downstream of the canonical stop codon in the aquaporin 4 (Aqp4) gene. Additional stop codons prevent unusual stop codon readthrough events generating a conserved C-terminally elongated variant of Aquaporin 4 (AQP4X). (J:351557)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Aqp4 Mutation: 45 strains or lines available

References

• Original: J:351557 Sapkota D, et al., Aqp4 stop codon readthrough facilitates amyloid-beta clearance from the brain. Brain. 2022 Sep 14;145(9):2982-2990
• All: 1 reference(s)