Pitx1^em1Andg
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pitx1^em1Andg
• Name: paired-like homeodomain transcription factor 1; endonuclease-mediated mutation 1, Guillaume Andrey
• MGI ID: MGI:7666521
• Synonyms: Pitx^-, Pitx^del
• Gene: Pitx1 Location: Chr13:55972864-55984005 bp, - strand Genetic Position: Chr13, 30.06 cM
• Alliance: Pitx1^em1Andg page

Mutation origin

• Germline Transmission: Earliest citation of germline transmission: J:268374
• Parent Cell Line: G4 (ES Cell)
• Strain of Origin: (129S6/SvEvTac x C57BL/6NCrl)F1

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: A 16-kb H3K27me3-enriched region surrounding Pitx1 was deleted using sgRNAs (equivalent to TATCCAGGCAGTTTCACCCC and GCTGTAGTTAAAGGAAGCTGGG) with CRISPR/Cas9 technology. (J:268374)

Expression

In Mice Carrying this Mutation:

1 RNA-Seq or microarray experiment(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Pitx1 Mutation: 11 strains or lines available

References

• Original: J:268374 Kragesteen BK, et al., Dynamic 3D chromatin architecture contributes to enhancer specificity and limb morphogenesis. Nat Genet. 2018 Oct;50(10):1463-1473
• All: 2 reference(s)