Del(15Hoxc13-Hoxc4)3Andg
Endonuclease-mediated Allele Detail

Summary

• Symbol: Del(15Hoxc13-Hoxc4)3Andg
• Name: deletion, Chr 15, Guillaume Andrey 3
• MGI ID: MGI:7666520
• Synonyms: Hoxc^del
• Gene: Del(15Hoxc13-Hoxc4)3Andg Location: unknown Genetic Position: Chr15, Syntenic

Mutation origin

• Germline Transmission: Earliest citation of germline transmission: J:268374
• Parent Cell Line: G4 (ES Cell)
• Strain of Origin: (129S6/SvEvTac x C57BL/6NCrl)F1

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Intergenic deletion, Intragenic deletion
• Del(15Hoxc13-Hoxc4)3Andg involves 9 genes/genome features (Hoxc13, Hoxc12, Hoxc11 ...) View all
• Mutation details: The entire Hoxc cluster (Hoxc13, Hoxc12, Hoxc11, Hoxc10, Hoxc9, Hoxc8, Hoxc6, Hoxc5, Hoxc4) was deleted using sgRNAs (equivalent to GCTTAATTTGGCCGACGCAA and GGAGCGTTCTTAAACCCGAT) with CRISPR/Cas9 technology. (J:268374)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Del(15Hoxc13-Hoxc4)3Andg Mutation: 0 strains or lines available

References

• Original: J:268374 Kragesteen BK, et al., Dynamic 3D chromatin architecture contributes to enhancer specificity and limb morphogenesis. Nat Genet. 2018 Oct;50(10):1463-1473
• All: 1 reference(s)