Del(13Gm47071-Macroh2a1)5Andg
Endonuclease-mediated Allele Detail

Summary

• Symbol: Del(13Gm47071-Macroh2a1)5Andg
• Name: deletion, Chr 13, Guillaume Andrey 5
• MGI ID: MGI:7666518
• Synonyms: Del(13Gm47071-Rr272802)5Andg, Pitx1^delL
• Gene: Del(13Gm47071-Macroh2a1)5Andg Location: unknown Genetic Position: Chr13, Syntenic

Mutation origin

• Germline Transmission: Earliest citation of germline transmission: J:268374
• Parent Cell Line: G4 (ES Cell)
• Strain of Origin: (129S6/SvEvTac x C57BL/6NCrl)F1

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region, Null/knockout)
• Mutations: Intergenic deletion, Intragenic deletion
• Del(13Gm47071-Macroh2a1)5Andg involves 3 genes/genome features (Gm47071, Macroh2a1, Gm31485) View all
• Mutation details: To mimic the human Liebenberg syndrome deletion, a 120-kb deletion (GRCm39:chr13:56186453-56306452) was engineered using sgRNAs (equivalent to AACAAGATGATACCGCATGG and ACCCACCAGTACGATCGCTC) with CRISPR/Cas9 technology. The deletion encompasses the 3' end of predicted lncRNA Gm47071, the Macroh2a1 gene, as well as numerous predicted CTCF-binding sites and predicted enhancers. (J:268374)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Del(13Gm47071-Macroh2a1)5Andg Mutation: 0 strains or lines available

References

• Original: J:268374 Kragesteen BK, et al., Dynamic 3D chromatin architecture contributes to enhancer specificity and limb morphogenesis. Nat Genet. 2018 Oct;50(10):1463-1473
• All: 1 reference(s)