Del(13Neudnr-Neurog1)4Andg
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Del(13Neudnr-Neurog1)4Andg |
| Name: |
deletion, Chr 13, Guillaume Andrey 4 |
| MGI ID: |
MGI:7666517 |
| Synonyms: |
Del(13Neudnr-Rr272815)4Andg, Neurog1del |
| Gene: |
Del(13Neudnr-Neurog1)4Andg Location: unknown Genetic Position: Chr13, Syntenic
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Modified regulatory region, Null/knockout) |
| Mutations: |
|
Intergenic deletion, Intragenic deletion
|
|
|
Del(13Neudnr-Neurog1)4Andg involves 2 genes/genome features (Neudnr, Neurog1)
View all
|
| |
|
Mutation details: A 50-kb H3K27me3-enriched polycomb-repressed domain surrounding Neurog1 (GRCm39:chr13:56366453-56416452) was deleted using sgRNAs (equivalent to TGACAGCGACATCTAAACTG and GGCAGGAAGAGAGATTCACT) with CRISPR/Cas9 technology. The deletion encompasses predicted lncRNA Neudnr, the Neurog1 gene, predicted CTCF-binding sites as well as numerous predicted enhancers.
(J:268374)
|
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Del(13Neudnr-Neurog1)4Andg Mutation: |
0 strains or lines available
|
|
| Original: |
J:268374 Kragesteen BK, et al., Dynamic 3D chromatin architecture contributes to enhancer specificity and limb morphogenesis. Nat Genet. 2018 Oct;50(10):1463-1473 |
| All: |
1 reference(s) |
|