Del(13Neudnr-Rr272815)4Andg
Endonuclease-mediated Allele Detail

Summary

• Symbol: Del(13Neudnr-Rr272815)4Andg
• Name: deletion, Chr 13, Guillaume Andrey 4
• MGI ID: MGI:7666517
• Synonyms: Neurog1^del
• Gene: Del(13Neudnr-Rr272815)4Andg Location: unknown Genetic Position: Chr13, Syntenic

Mutation origin

• Germline Transmission: Earliest citation of germline transmission: J:268374
• Parent Cell Line: G4 (ES Cell)
• Strain of Origin: (129S6/SvEvTac x C57BL/6NCrl)F1

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region, Null/knockout)
• Mutations: Intergenic deletion, Intragenic deletion
• Del(13Neudnr-Rr272815)4Andg involves 2 genes/genome features (Neudnr, Neurog1) View all
• Mutation details: A 50-kb H3K27me3-enriched polycomb-repressed domain surrounding Neurog1 (GRCm39:chr13:56366453-56416452) was deleted using sgRNAs (equivalent to TGACAGCGACATCTAAACTG and GGCAGGAAGAGAGATTCACT) with CRISPR/Cas9 technology. The deletion encompasses predicted lncRNA Neudnr, the Neurog1 gene, predicted CTCF-binding site Rr272815 and other predicted CTCF-binding sites as well as a predicted enhancer. (J:268374)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Del(13Neudnr-Rr272815)4Andg Mutation: 0 strains or lines available

References

• Original: J:268374 Kragesteen BK, et al., Dynamic 3D chromatin architecture contributes to enhancer specificity and limb morphogenesis. Nat Genet. 2018 Oct;50(10):1463-1473
• All: 1 reference(s)