About   Help   FAQ
Rr491em1Mam
Endonuclease-mediated Allele Detail
Summary
Symbol: Rr491em1Mam
Name: regulatory region 491; endonuclease-mediated mutation 1, Lothar Hennighausen
MGI ID: MGI:7664605
Synonyms: Csn2-deltaP
Gene: Rr491  Location: Chr5:87847378-87847414 bp  Genetic Position: Chr5, Syntenic
Alliance: Rr491em1Mam page
Mutation
origin
Strain of Origin:  C57BL/6N
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Intragenic deletion
 
Mutation detailsThe Csn2 promoter was modified with GRCm39:g.chr5:8784737C>T and 87847422G>A nucleotide mutations in two GAS motifs using sgRNAs (equivalent to TCAATTCCAAGAAGTCTACGTGA and TTCTTGGGAAAGACAATAGA) and an ssODN template with CRISPR/Cas9 technology. (J:341588)
Expression
In Mice Carrying this Mutation: 1 RNA-Seq or microarray experiment(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rr491 Mutation:  0 strains or lines available
References
Original:  J:341588 Lee HK, et al., Cell-specific and shared regulatory elements control a multigene locus active in mammary and salivary glands. Nat Commun. 2023 Aug 17;14(1):4992
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/13/2026
MGI 6.24
The Jackson Laboratory