Rr491^em1Mam
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr491^em1Mam
• Name: regulatory region 491; endonuclease-mediated mutation 1, Lothar Hennighausen
• MGI ID: MGI:7664605
• Synonyms: Csn2-deltaP
• Gene: Rr491 Location: Chr5:87847378-87847414 bp Genetic Position: Chr5, Syntenic
• Alliance: Rr491^em1Mam page

Mutation origin

• Strain of Origin: C57BL/6N

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intragenic deletion
• Mutation details: The Csn2 promoter was modified with GRCm39:g.chr5:8784737C>T and 87847422G>A nucleotide mutations in two GAS motifs using sgRNAs (equivalent to TCAATTCCAAGAAGTCTACGTGA and TTCTTGGGAAAGACAATAGA) and an ssODN template with CRISPR/Cas9 technology. (J:341588)

Expression

In Mice Carrying this Mutation:

1 RNA-Seq or microarray experiment(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr491 Mutation: 0 strains or lines available

References

• Original: J:341588 Lee HK, et al., Cell-specific and shared regulatory elements control a multigene locus active in mammary and salivary glands. Nat Commun. 2023 Aug 17;14(1):4992
• All: 1 reference(s)