About   Help   FAQ
Rr484em2Mam
Endonuclease-mediated Allele Detail
Summary
Symbol: Rr484em2Mam
Name: regulatory region 484; endonuclease-mediated mutation 2, Lothar Hennighausen
MGI ID: MGI:7664594
Synonyms: Csn3-deltaE2S/N
Gene: Rr484  Location: Chr5:88072048-88073118 bp  Genetic Position: Chr5, Syntenic
Alliance: Rr484em2Mam page
Mutation
origin
Strain of Origin:  C57BL/6N
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Intergenic deletion
 
Mutation detailsThe proximal Csn2 enhancer was deleted using sgRNAs (equivalent to CAGGTCATCCTATTGCCTCAAGG and GTGTAATGGTTCCCAGAAACAGG) with CRISPR/Cas9 technology, resulting in a 1071 bp deletion. The deletion includes the GAS, GR and NFIB motifs. (J:341588)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rr484 Mutation:  0 strains or lines available
References
Original:  J:341588 Lee HK, et al., Cell-specific and shared regulatory elements control a multigene locus active in mammary and salivary glands. Nat Commun. 2023 Aug 17;14(1):4992
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory