Rr484^em2Mam
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr484^em2Mam
• Name: regulatory region 484; endonuclease-mediated mutation 2, Lothar Hennighausen
• MGI ID: MGI:7664594
• Synonyms: Csn3-deltaE2S/N
• Gene: Rr484 Location: Chr5:88072048-88073118 bp Genetic Position: Chr5, Syntenic
• Alliance: Rr484^em2Mam page

Mutation origin

• Strain of Origin: C57BL/6N

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intergenic deletion
• Mutation details: The proximal Csn2 enhancer was deleted using sgRNAs (equivalent to CAGGTCATCCTATTGCCTCAAGG and GTGTAATGGTTCCCAGAAACAGG) with CRISPR/Cas9 technology, resulting in a 1071 bp deletion. The deletion includes the GAS, GR and NFIB motifs. (J:341588)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr484 Mutation: 0 strains or lines available

References

• Original: J:341588 Lee HK, et al., Cell-specific and shared regulatory elements control a multigene locus active in mammary and salivary glands. Nat Commun. 2023 Aug 17;14(1):4992
• All: 1 reference(s)