About   Help   FAQ
Rr483em1Mam
Endonuclease-mediated Allele Detail
Summary
Symbol: Rr483em1Mam
Name: regulatory region 483; endonuclease-mediated mutation 1, Lothar Hennighausen
MGI ID: MGI:7664592
Synonyms: Csn3-deltaE1
Gene: Rr483  Location: Chr5:88064501-88066580 bp  Genetic Position: Chr5, Syntenic
Alliance: Rr483em1Mam page
Mutation
origin
Strain of Origin:  C57BL/6N
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Intergenic deletion
 
Mutation detailsThe distal Csn3 enhancer was deleted using sgRNAs (equivalent to GGCTATCCATTTTCTGCTGTAGG, TTGTCCAACAGAGATTTTGTTGG and AAGTGAAGGTCAGCGTAATGAGG) with CRISPR/Cas9 technology, resulting in a 2080 bp deletion. (J:341588)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rr483 Mutation:  0 strains or lines available
References
Original:  J:341588 Lee HK, et al., Cell-specific and shared regulatory elements control a multigene locus active in mammary and salivary glands. Nat Commun. 2023 Aug 17;14(1):4992
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory