About   Help   FAQ
Rr479em1Mam
Endonuclease-mediated Allele Detail
Summary
Symbol: Rr479em1Mam
Name: regulatory region 479; endonuclease-mediated mutation 1, Lothar Hennighausen
MGI ID: MGI:7664588
Synonyms: Csn1s1-deltaE1
Gene: Rr479  Location: Chr5:87802256-87802266 bp  Genetic Position: Chr5, Syntenic
Alliance: Rr479em1Mam page
Mutation
origin
Strain of Origin:  C57BL/6N
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Intergenic deletion
 
Mutation detailsThe Csn1s1 distal enhancer was deleted using an sgRNA (equivalent to AATTGATTCAGAACATGTCCAGG) with CRISPR/Cas9 technology, resulting in an 11 bp deletion. (J:341588)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rr479 Mutation:  0 strains or lines available
References
Original:  J:341588 Lee HK, et al., Cell-specific and shared regulatory elements control a multigene locus active in mammary and salivary glands. Nat Commun. 2023 Aug 17;14(1):4992
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory