Rr487^em1Mam
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr487^em1Mam
• Name: regulatory region 487; endonuclease-mediated mutation 1, Lothar Hennighausen
• MGI ID: MGI:7664584
• Synonyms: SE-deltaE2
• Gene: Rr487 Location: Chr5:88024456-88025178 bp Genetic Position: Chr5, Syntenic
• Alliance: Rr487^em1Mam page

Mutation origin

• Strain of Origin: C57BL/6N

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intergenic deletion
• Mutation details: The enhancer, part of casein gene cluster super-enhancer Rr485, was deleted using sgRNAs (equivalent to TATACAGGAGGTTTGGAACTCCAGG and GGAATAATTTGGGGTCAGTGAGG) with CRISPR/Cas9 technology, resulting in a 723 bp deletion. (J:341588)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr487 Mutation: 0 strains or lines available

References

• Original: J:341588 Lee HK, et al., Cell-specific and shared regulatory elements control a multigene locus active in mammary and salivary glands. Nat Commun. 2023 Aug 17;14(1):4992
• All: 1 reference(s)