Gata2^{em2(Ccnb1*)Cfplu}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gata2^{em2(Ccnb1*)Cfplu}
• Name: GATA binding protein 2; endonuclease-mediated mutation 2, Carlos-Filipe Pereira
• MGI ID: MGI:7661031
• Synonyms: MDmut-Gata2
• Gene: Gata2 Location: Chr6:88170873-88184014 bp, + strand Genetic Position: Chr6, 39.2 cM
• Alliance: Gata2^{em2(Ccnb1*)Cfplu} page

Mutation origin

• Germline Transmission: Earliest citation of germline transmission: J:339095
• Parent Cell Line: Not Specified (ES Cell)
• Strain of Origin: (C57BL/6N x 129/Sv)F1

Mutation description

• Allele Type: Endonuclease-mediated (Inserted expressed sequence)
• Mutation: Insertion
• Gata2^{em2(Ccnb1*)Cfplu} expresses 1 gene
  Knock-in expresses:
  

  Organism	Expressed Gene	Note
  mouse	Ccnb1 (MGI:88302)	a mutated (R42A) mitotic degradation (MD) domain sequence

• Mutation details: Using CRISPR/Cas9 endonuclease-mediated genome editing, a guide RNA (GACACAGTAGTGGACCATGGAGG) was used to introduce a mutated (R42A) mitotic degradation (MD) domain sequence of cyclin B1 (Ccnb1) inserted after the start codon in exon 2 of the GATA binding protein 2 gene (Gata2) on chromosome 6. (J:339095)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Gata2 Mutation: 30 strains or lines available

References

• Original: J:339095 Silverio-Alves R, et al., GATA2 mitotic bookmarking is required for definitive haematopoiesis. Nat Commun. 2023 Aug 14;14(1):4645
• All: 1 reference(s)