About   Help   FAQ
Gata2em2(Ccnb1*)Cfplu
Endonuclease-mediated Allele Detail
Summary
Symbol: Gata2em2(Ccnb1*)Cfplu
Name: GATA binding protein 2; endonuclease-mediated mutation 2, Carlos-Filipe Pereira
MGI ID: MGI:7661031
Synonyms: MDmut-Gata2
Gene: Gata2  Location: Chr6:88170873-88184014 bp, + strand  Genetic Position: Chr6, 39.2 cM
Alliance: Gata2em2(Ccnb1*)Cfplu page
Mutation
origin
Germline Transmission:  Earliest citation of germline transmission: J:339095
Parent Cell Line:  Not Specified (ES Cell)
Strain of Origin:  (C57BL/6N x 129/Sv)F1
Mutation
description
Allele Type:    Endonuclease-mediated (Inserted expressed sequence)
Mutation:    Insertion
 
Gata2em2(Ccnb1*)Cfplu expresses 1 gene
 
Mutation detailsUsing CRISPR/Cas9 endonuclease-mediated genome editing, a guide RNA (GACACAGTAGTGGACCATGGAGG) was used to introduce a mutated (R42A) mitotic degradation (MD) domain sequence of cyclin B1 (Ccnb1) inserted after the start codon in exon 2 of the GATA binding protein 2 gene (Gata2) on chromosome 6. (J:339095)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Gata2 Mutation:  29 strains or lines available
References
Original:  J:339095 Silverio-Alves R, et al., GATA2 mitotic bookmarking is required for definitive haematopoiesis. Nat Commun. 2023 Aug 14;14(1):4645
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory