Col4a5^em1Jhm
Endonuclease-mediated Allele Detail

Summary

• Symbol: Col4a5^em1Jhm
• Name: collagen, type IV, alpha 5; endonuclease-mediated mutation 1, Jeffrey H Miner
• MGI ID: MGI:7645885
• Synonyms: Col4a5-R1563X, Col4a5^R1563X
• Gene: Col4a5 Location: ChrX:140258381-140472230 bp, + strand Genetic Position: ChrX, 62.16 cM
• Alliance: Col4a5^em1Jhm page

Mutation origin

• Strain of Origin: FVB/NJ

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Single point mutation
• Mutation details: Arginine codon 1569 (CGA), shared between exon 50 and 51, was changed to a stop codon (TGA) (ENSMUSP00000108553:p.R1569*) using an sgRNA (equivalent to CAGCCATTCATTAGTCGGTA) and an ssODN template with CRISPR/Cas9 technology. (J:347543)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Col4a5 Mutation: 15 strains or lines available

References

• Original: J:347543 Omachi K, et al., NanoLuc reporters identify COL4A5 nonsense mutations susceptible to drug-induced stop codon readthrough. iScience. 2022 Mar 18;25(3):103891
• All: 1 reference(s)