About   Help   FAQ
Appem2Aduci
Endonuclease-mediated Allele Detail
Summary
Symbol: Appem2Aduci
Name: amyloid beta precursor protein; endonuclease-mediated mutation 2, Frank LaFerla
MGI ID: MGI:7645731
Gene: App  Location: Chr16:84751236-84972187 bp, - strand  Genetic Position: Chr16, 46.92 cM, cytoband C3-qter
Alliance: Appem2Aduci page
Mutation
origin
Strain of Origin:  B6(Cg)-Appem1Aduci/J
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Nucleotide substitutions
 
Mutation detailsA guide RNA (CACCAGGGTGATGACAATCA) was designed to produce the I716F (Iberian) mutation in exon 17 of the amyloid beta precursor protein (App) gene. Specifically, the mutations change an isoleucine (I) to phenylalanine (F) in APP. This targetted mutation was made in App zygote containing a loxP site upstream of exon 14, 3 point mutations inserted into exon 14 to create amino acid substitutions (amino acids 5 (G->R), 10 (F->Y) and 13 (R->H)) (ENSMUSE00000131684), a loxP site downstream of exon 14 and the KM670/671NL (Swedish) mutations in exon 16 of the amyloid beta precursor protein (App) gene. (J:101977)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any App Mutation:  118 strains or lines available
References
Original:  J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory