Appem1Aduci
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Appem1Aduci |
| Name: |
amyloid beta precursor protein; endonuclease-mediated mutation 1, Frank LaFerla |
| MGI ID: |
MGI:7645709 |
| Gene: |
App Location: Chr16:84751236-84972187 bp, - strand Genetic Position: Chr16, 46.92 cM, cytoband C3-qter
|
| Alliance: |
Appem1Aduci page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Humanized sequence) |
| Mutation: |
|
Nucleotide substitutions
|
| |
|
Mutation details: A guide RNA (AGAGATCTCGGAAGTGAAGA) was designed to produce the KM670/671NL (Swedish) mutations in exon 16 of the amyloid beta precursor protein (App) gene. Specifically, the mutations change a lysine (K) and methionine (M) in APP to asparagine (N) and leucine (L). This targeted mutation was made in App zygote containing a loxP site upstream of exon 14, 3 point mutations inserted into exon 14 to create amino acid substitutions (amino acids 5 (G->R), 10 (F->Y) and 13 (R->H)) (ENSMUSE00000131684), a loxP site downstream of exon 14.
(J:101977)
|
|
|
|
|
| Original: |
J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017; |
| All: |
1 reference(s) |
|