Tardbp^em1Lmit
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tardbp^em1Lmit
• Name: TAR DNA binding protein; endonuclease-mediated mutation 1, Lars M Ittner
• MGI ID: MGI:7645439
• Synonyms: Tardbp^N390D
• Gene: Tardbp Location: Chr4:148696839-148711476 bp, - strand Genetic Position: Chr4, 78.77 cM
• Alliance: Tardbp^em1Lmit page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Single point mutation
• Mutation details: Asparagine codon 390 (AAT) in exon 6 was changed to aspartic acid (GAT) (p.N390D) using sgRNAs (equivalent to TGGGGGTCAGCATCAAATGC and GTCAGCATCAAATGCAGGAT) and an ssODN template with CRISPR/Cas9 technology. The mutation results in ALS-like phenotypes in mice at advanced ages with spinal cord motor neuron loss from age 6 months. (J:348663)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Tardbp Mutation: 83 strains or lines available

References

• Original: J:348663 Ke YD, et al., Targeting 14-3-3theta-mediated TDP-43 pathology in amyotrophic lateral sclerosis and frontotemporal dementia mice. Neuron. 2024 Apr 17;112(8):1249-1264.e8
• All: 1 reference(s)