About   Help   FAQ
Mslnem2Strom
Endonuclease-mediated Allele Detail
Summary
Symbol: Mslnem2Strom
Name: mesothelin; endonuclease-mediated mutation 2, Ingunn Stromnes
MGI ID: MGI:7645424
Synonyms: Msln-
Gene: Msln  Location: Chr17:25967587-25973352 bp, - strand  Genetic Position: Chr17, 12.85 cM, cytoband A3.3
Alliance: Mslnem2Strom page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsUsing CRISPR/Cas9 technology, SgRNAs recognizing exon 4 of Msln (GGCCAAGAAAGAGGCCUGUG; +25753054; ENSMUST00000238120) were targetted result in Msln indel causing disruption. (J:333043)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Msln Mutation:  38 strains or lines available
References
Original:  J:333043 Rollins MR, et al., Germline T cell receptor exchange results in physiological T cell development and function. Nat Commun. 2023 Feb 1;14(1):528
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory