Epm2a^em1Pro
Endonuclease-mediated Allele Detail

Summary

• Symbol: Epm2a^em1Pro
• Name: epilepsy, progressive myoclonic epilepsy, type 2 gene alpha; endonuclease-mediated mutation 1, Peter J Roach
• MGI ID: MGI:7643617
• Synonyms: LaforinC265S
• Gene: Epm2a Location: Chr10:11219148-11335388 bp, + strand Genetic Position: Chr10, 3.66 cM, cytoband A
• Alliance: Epm2a^em1Pro page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Nucleotide substitutions
• Mutation details: Cysteine codon 265 (TGC) in exon 4 was changed to serine (TCT) (p.C265S) using an sgRNA (targeting GTGTATGTCCACTGCAACGC) and an ssODN template with CRISPR/Cas9 technology. The mutation renders the encoded peptide catalytically inactive. (J:348085)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Epm2a Mutation: 25 strains or lines available

References

• Original: J:348085 Skurat AV, et al., Impaired malin expression and interaction with partner proteins in Lafora disease. J Biol Chem. 2024 Apr 7;300(5):107271
• All: 1 reference(s)