About   Help   FAQ
Nhlrc1em1Pro
Endonuclease-mediated Allele Detail
Summary
Symbol: Nhlrc1em1Pro
Name: NHL repeat containing 1; endonuclease-mediated mutation 1, Peter J Roach
MGI ID: MGI:7643616
Synonyms: malin-myc
Gene: Nhlrc1  Location: Chr13:47166033-47168326 bp, - strand  Genetic Position: Chr13, 24.5 cM
Alliance: Nhlrc1em1Pro page
Mutation
origin
Strain of Origin:  C57BL/6
Mutation
description
Allele Type:    Endonuclease-mediated (Epitope tag)
Mutation:    Insertion
 
Mutation detailsGCG linker sequence, followed by sequence for a double c-myc tag, was inserted immediately upstream of the stop codon using an sgRNA (targeting AAGTGATGGAGGGCAACGGA) and an ssODN template with CRISPR/Cas9 technology. (J:348085)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Nhlrc1 Mutation:  16 strains or lines available
References
Original:  J:348085 Skurat AV, et al., Impaired malin expression and interaction with partner proteins in Lafora disease. J Biol Chem. 2024 Apr 7;300(5):107271
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory