Nhlrc1^em1Pro
Endonuclease-mediated Allele Detail

Summary

• Symbol: Nhlrc1^em1Pro
• Name: NHL repeat containing 1; endonuclease-mediated mutation 1, Peter J Roach
• MGI ID: MGI:7643616
• Synonyms: malin-myc
• Gene: Nhlrc1 Location: Chr13:47166033-47168326 bp, - strand Genetic Position: Chr13, 24.5 cM
• Alliance: Nhlrc1^em1Pro page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Epitope tag)
• Mutation: Insertion
• Mutation details: GCG linker sequence, followed by sequence for a double c-myc tag, was inserted immediately upstream of the stop codon using an sgRNA (targeting AAGTGATGGAGGGCAACGGA) and an ssODN template with CRISPR/Cas9 technology. (J:348085)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Nhlrc1 Mutation: 16 strains or lines available

References

• Original: J:348085 Skurat AV, et al., Impaired malin expression and interaction with partner proteins in Lafora disease. J Biol Chem. 2024 Apr 7;300(5):107271
• All: 1 reference(s)