About   Help   FAQ
Hbb-btem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Hbb-btem1(IMPC)J
Name: hemoglobin, beta adult t chain; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7643239
Gene: Hbb-bt  Location: Chr7:103461731-103463130 bp, - strand  Genetic Position: Chr7, Syntenic
Alliance: Hbb-btem1(IMPC)J page
IMPC: Hbb-bt gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: ATAAGTGGTGAGATAGTAAG and ATGACAACCATATCTACACA. This resulted in a 1,769 bp deletion of Chr7:103,812,287-103,814,055(GRCm38/mm10) that removes exons ENSMUSE00000633129 through ENSMUSE00000633127. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Hbb-bt Mutation:  4 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
08/05/2025
MGI 6.24
The Jackson Laboratory