Tpd52^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tpd52^em1(IMPC)J
• Name: tumor protein D52; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7643224
• Gene: Tpd52 Location: Chr3:8991590-9069824 bp, - strand Genetic Position: Chr3, 2.23 cM, cytoband A1-A2
• Alliance: Tpd52^em1(IMPC)J page
• IMPC: Tpd52 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: CCGATTGTCACGCTTCTAGG and GATGCTATCGTCGCCTCTGG. This resulted in a 284 bp deletion of Chr3:8,947,447-8,947,730 (GRCm38/mm10) that removes exon ENSMUSE00000640154. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Tpd52 Mutation: 96 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)