Usp24^em1Janjh
Endonuclease-mediated Allele Detail

Summary

• Symbol: Usp24^em1Janjh
• Name: ubiquitin specific peptidase 24; endonuclease-mediated mutation 1, Jan-Jong Hung
• MGI ID: MGI:7642171
• Synonyms: USP24^C1695A
• Gene: Usp24 Location: Chr4:106173417-106298519 bp, + strand Genetic Position: Chr4, 49.44 cM, cytoband C7
• Alliance: Usp24^em1Janjh page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Nucleotide substitutions
• Mutation details: Cysteine codon 1695 (TGT) in exon 43 was changed to alanine (GCT) (p.C1695A) using an sgRNA (equivalent to ACGGTGGCGCCACTGCTTACATGAATGCAGTGTTCCAGCAGC) and an ssODN template with CRISPR/Cas9 technology. The mutation eliminates the peptidase activity of the encoded peptide. (J:348295)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Usp24 Mutation: 110 strains or lines available

References

• Original: J:348295 Young MJ, et al., USP24-i-101 targeting of USP24 activates autophagy to inhibit drug resistance acquired during cancer therapy. Cell Death Differ. 2024 May;31(5):574-591
• All: 2 reference(s)