N4bp1em3Vmd
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
N4bp1em3Vmd |
| Name: |
NEDD4 binding protein 1; endonuclease-mediated mutation 3, Vishva M Dixit |
| MGI ID: |
MGI:7641929 |
| Synonyms: |
N4bp1deltaUb |
| Gene: |
N4bp1 Location: Chr8:87567764-87612489 bp, - strand Genetic Position: Chr8, 42.1 cM
|
| Alliance: |
N4bp1em3Vmd page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Not Applicable) |
| Mutation: |
|
Nucleotide substitutions
|
| |
|
Mutation details: Isoleucine codon 861 (ATC), phenylalanine codon 862 (TTC) and proline codon 863 (CCT) in exon 7 were changed to alanine (GCC) (p.I861_P863AdelIFPinsAAA) using an sgRNA (CAGCGCCUCCCUCAGCUCGC) and an ssODN template with CRISPR/Cas9 technology. The mutation eliminates the ubiquitin-binding activity of the encoded peptide.
(J:348311)
|
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any N4bp1 Mutation: |
47 strains or lines available
|
|
| Original: |
J:348311 Gitlin AD, et al., N4BP1 coordinates ubiquitin-dependent crosstalk within the IkappaB kinase family to limit Toll-like receptor signaling and inflammation. Immunity. 2024 May 14;57(5):973-986.e7 |
| All: |
1 reference(s) |
|