N4bp1^em3Vmd
Endonuclease-mediated Allele Detail

Summary

• Symbol: N4bp1^em3Vmd
• Name: NEDD4 binding protein 1; endonuclease-mediated mutation 3, Vishva M Dixit
• MGI ID: MGI:7641929
• Synonyms: N4bp1^deltaUb
• Gene: N4bp1 Location: Chr8:87567764-87612489 bp, - strand Genetic Position: Chr8, 42.1 cM
• Alliance: N4bp1^em3Vmd page

Mutation origin

• Strain of Origin: C57BL/6N

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Nucleotide substitutions
• Mutation details: Isoleucine codon 861 (ATC), phenylalanine codon 862 (TTC) and proline codon 863 (CCT) in exon 7 were changed to alanine (GCC) (p.I861_P863AdelIFPinsAAA) using an sgRNA (CAGCGCCUCCCUCAGCUCGC) and an ssODN template with CRISPR/Cas9 technology. The mutation eliminates the ubiquitin-binding activity of the encoded peptide. (J:348311)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any N4bp1 Mutation: 46 strains or lines available

References

• Original: J:348311 Gitlin AD, et al., N4BP1 coordinates ubiquitin-dependent crosstalk within the IkappaB kinase family to limit Toll-like receptor signaling and inflammation. Immunity. 2024 May 14;57(5):973-986.e7
• All: 1 reference(s)