About   Help   FAQ
N4bp1em2Vmd
Endonuclease-mediated Allele Detail
Summary
Symbol: N4bp1em2Vmd
Name: NEDD4 binding protein 1; endonuclease-mediated mutation 2, Vishva M Dixit
MGI ID: MGI:7641928
Synonyms: N4bp1D621A
Gene: N4bp1  Location: Chr8:87567764-87612489 bp, - strand  Genetic Position: Chr8, 42.1 cM
Alliance: N4bp1em2Vmd page
Mutation
origin
Strain of Origin:  C57BL/6N
Mutation
description
Allele Type:    Endonuclease-mediated (Not Applicable)
Mutation:    Nucleotide substitutions
 
Mutation detailsAspartic acid codon 621 (GAT) in exon 2 was changed to alanine (GCC) (p.D621A) using an sgRNA (CUGGAAUUAAAAAACGAACC) and an ssODN template with CRISPR/Cas9 technology. The mutation eliminates the RNase activity of the encoded peptide. (J:348311)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any N4bp1 Mutation:  46 strains or lines available
References
Original:  J:348311 Gitlin AD, et al., N4BP1 coordinates ubiquitin-dependent crosstalk within the IkappaB kinase family to limit Toll-like receptor signaling and inflammation. Immunity. 2024 May 14;57(5):973-986.e7
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory